Journal: Nature Communications

Article Title: Spatial-fluxomics provides a subcellular-compartmentalized view of reductive glutamine metabolism in cancer cells

doi: 10.1038/s41467-019-09352-1

Figure Lengend Snippet: An approach for quantifying mitochondrial and cytosolic metabolite levels. a Rapid cell fractionation effectively removes cytosolic components (green) without damaging mitochondrial membrane. Mitochondria retain MitoTracker (red) after digitonin-based cell fractionation. While nucleus (blue) remains intact within the mitochondrial fraction, it should not bias the mitochondrial metabolite pool size measurements due to the free diffusion of small molecules through nuclear pore complexes into the cytosolic fraction. b The purity of the mitochondria and cytosol-enriched fractions in terms of the expression of mitochondrial (citrate synthase; CS, red) and cytosolic marker proteins (glyceraldehyde-phosphate dehydrogenase; GAPDH, green) via quantitative western blot (three biological replicates are shown). c – d The extent of cross-contamination between the mitochondrial and cytosolic fractions based on mitochondrial and cytosolic protein (western blot, green) and small-molecule markers (LC-MS, orange). Tetramethylrhodamine methyl ester (TMRM) was introduced as a mitochondria-specific small-molecule marker. e A comparison of the sum of measured metabolite pools in the two subcellular fractions to that measured in whole-cell extracts; a cumulative distribution shows the number of metabolites ( y -axis) for which the sum of pool sizes in the two fractions deviates by different extent from the whole-cell measurements ( x -axis). f Delay in the quenching of metabolism in the mitochondrial fraction (by 1, 5, 10, and 30 min) leads to reduced pool sizes due to the diffusion of small molecules out of mitochondria; a cumulative distribution shows the number of metabolites ( y -axis) for which the fractional pool size in the mitochondrial fraction drops by different extent ( x -axis). g The deconvolution function used to infer metabolite pool size ratio in mitochondria versus cytosol ( y -axis) given the measured pool size ratio ( x -axis), considering the cross-contamination between the two fractions. Confidence intervals of the deconvoluted pool size rations are shown considering 5% (orange) and 10% (green) coefficient of variance (CV) in the measured pool sizes in the mitochondrial and cytosolic fractions. h The ratio of metabolite pool sizes in mitochondria versus cytosol for 42 metabolites in HeLa cells under standard normoxic condition; glycolytic and pentose phosphate pathway metabolites (orange) and TCA cycle metabolites (green). Data are mean ± SD, n = 3 independent biological replicates

Article Snippet: Mitochondria were prepared with the magnetic beads method (Mitochondria Isolation Kit; Miltenyi Biotec,), and the resulting mitochondrial pellets were reconstituted in assay buffer (125 mM KCl, 10 mM Tris/MOPS, 0.1 mM EGTA/Tris, 1 mM Pi, pH 7.4) supplied with indicated nutrients and tracer .

Techniques: Cell Fractionation, Membrane, Diffusion-based Assay, Expressing, Marker, Western Blot, Liquid Chromatography with Mass Spectroscopy, Comparison

Journal: Nature Communications

Article Title: Spatial-fluxomics provides a subcellular-compartmentalized view of reductive glutamine metabolism in cancer cells

doi: 10.1038/s41467-019-09352-1

Figure Lengend Snippet: Compartment-specific isotope tracing in mitochondria and cytosol. a A schematic description of the spatial-fluxomics approach. b TCA cycle metabolism and associated reactions involving acetyl-CoA and fatty acid metabolism. c Isotopic labeling kinetics of citrate m + 2 in mitochondria versus cytosol when feeding HeLa cells with [U- 13 C]-glucose; showing the ratio between the relative abundance of the m + 2 form of citrate in the mitochondria (out of the entire mitochondrial pool) divided by the relative abundance of citrate m + 2 in cytosol. d – f The isotopic labeling kinetics of citrate m + 4 ( d ), glutamine m + 5 ( e ), and glutamate m + 5 ( f ) when feeding [U- 13 C]-glutamine. Data are mean ± SD, n = 3 independent biological replicates

Article Snippet: Mitochondria were prepared with the magnetic beads method (Mitochondria Isolation Kit; Miltenyi Biotec,), and the resulting mitochondrial pellets were reconstituted in assay buffer (125 mM KCl, 10 mM Tris/MOPS, 0.1 mM EGTA/Tris, 1 mM Pi, pH 7.4) supplied with indicated nutrients and tracer .

Techniques: Isotopic Labeling

Journal: Nature Communications

Article Title: Spatial-fluxomics provides a subcellular-compartmentalized view of reductive glutamine metabolism in cancer cells

doi: 10.1038/s41467-019-09352-1

Figure Lengend Snippet: A quantitative view of mitochondrial and cytosolic fluxes in the TCA cycle and citrate metabolism under normoxia. a – d Mass-isotopomer labeling kinetics of citrate in mitochondria ( a ) and cytosol ( b ), and malate in mitochondria ( c ) and cytosol ( d ) when feeding HeLa cells with [U- 13 C]-glutamine under standard normoxic conditions. e Measured isotopic labeling ratio in HeLa cells for citrate m + 5 /m + 4 and malate m + 3 /m + 4 in media (red) in comparison to the expected labeling via computational simulation, considering the measured labeling kinetics of citrate and malate in mitochondria (green) and cytosol (orange). f Gibbs free energy of mitochondrial (IDH2/3) and cytosolic (IDH1) IDH isozymes (in the oxidative direction) in HeLa cells under normoxia (green) and hypoxia (red). g Mitochondrial and cytosolic fluxes, showing percentage from citrate synthase flux (which is 0.48 mM h −1 ). Arrow represents the direction of net flux; number represents net flux in the direction of the arrow and number in parenthesis correspond to the backward flux. Confidence intervals for estimated fluxes are shown in Supplementary Data . h The measured mass-isotopomer distribution of palmitate when feeding cells with [U- 13 C]-glutamine (green) is consistent with the simulated fit (orange). For the simulation, acetyl-CoA labeling was assumed to follow a binomial distribution with a probability of 7.1% having m + 2 labeling form. i Validation of the method based on knock-down of IDH1 or IDH2 genes and following citrate isotopic labeling after feeding cells with [U- 13 C]-glutamine. Upon IDH1 knockdown, the ratios between citrate m + 5 and m + 4 in mitochondria and cytosol are similar, indicating that all reductive glutamine flux occurred in mitochondria (where citrate m + 4 is produced from malate m + 4). Meanwhile, IDH2 knockdown resulted in a higher citrate m + 5 to m + 4 ratio in cytosol, indicating that reductive IDH1 remains active. n.s. not significant. * P < 0.05 and ** P < 0.01 by two-sample t -test. Data are mean ± SD, n = 3 independent biological replicates

Article Snippet: Mitochondria were prepared with the magnetic beads method (Mitochondria Isolation Kit; Miltenyi Biotec,), and the resulting mitochondrial pellets were reconstituted in assay buffer (125 mM KCl, 10 mM Tris/MOPS, 0.1 mM EGTA/Tris, 1 mM Pi, pH 7.4) supplied with indicated nutrients and tracer .

Techniques: Labeling, Isotopic Labeling, Comparison, Biomarker Discovery, Knockdown, Produced

Journal: Nature Communications

Article Title: Spatial-fluxomics provides a subcellular-compartmentalized view of reductive glutamine metabolism in cancer cells

doi: 10.1038/s41467-019-09352-1

Figure Lengend Snippet: Metabolic rewiring of mitochondrial and cytosolic fluxes under hypoxia. a, b Mass-isotopomer labeling kinetics of citrate in mitochondria ( a ) and cytosol ( b ) when feeding HeLa cells with [U- 13 C]-glutamine under hypoxia. c Mitochondrial to cytosolic metabolite pool size ratios ( y -axis) under normoxia (green) and hypoxia (orange) in HeLa cells; average fold change in whole-cell pool size under normoxia and hypoxia is indicated by color ( x -axis). d Mitochondrial and cytosolic fluxes in HeLa cells under hypoxia, showing percentages from citrate synthase flux in normoxia. Arrow represents the direction of net flux; number represents net flux in the direction of the arrow and number in parenthesis correspond to the backward flux. Confidence intervals for estimated fluxes shown in Supplementary Data . * P < 0.05, ** P < 0.01, and *** P < 0.001 by two-sample t -test. Data are mean ± SD, n = 3 independent biological replicates

Article Snippet: Mitochondria were prepared with the magnetic beads method (Mitochondria Isolation Kit; Miltenyi Biotec,), and the resulting mitochondrial pellets were reconstituted in assay buffer (125 mM KCl, 10 mM Tris/MOPS, 0.1 mM EGTA/Tris, 1 mM Pi, pH 7.4) supplied with indicated nutrients and tracer .

Techniques: Labeling

Journal: Nature Communications

Article Title: Spatial-fluxomics provides a subcellular-compartmentalized view of reductive glutamine metabolism in cancer cells

doi: 10.1038/s41467-019-09352-1

Figure Lengend Snippet: Reversed CS flux supports cell survival and growth in SDH-deficient cells. a , b Isotopic labeling kinetics of cytosolic and mitochondrial citrate m + 5 and mitochondrial malate m + 3 when feeding SDH-WT ( a ) and SDH-KO cells ( b ) with [U- 13 C]-glutamine. c Mitochondrial to cytosolic metabolite pool size ratios ( y -axis) in SDH-WT (green) and SDH-KO cells (orange); average fold change in whole-cell pool size upon SDH deficiency is indicated by color ( x -axis). d Gibbs free energy of mitochondrial (IDH2/3) and cytosolic (IDH1) IDH isozymes (in the oxidative direction) in SDH-proficient (green) and deficient cells (orange). e Mitochondrial and cytosolic fluxes in SDH-KO cells, showing percentages from citrate synthase flux in the SDH-positive cells. Arrow represents the direction of net flux; number represents net flux in the direction of the arrow and number in parenthesis correspond to the backward flux. Confidence intervals for estimated fluxes shown in Supplementary Data 8. f Protein expression of mitochondrial and cytosolic markers in isolated mitochondria from SDH-WT and KO cells. g Fractional labeling of acetyl-CoA (m + 2) and malate (m + 4) in isolated mitochondria cultured with [U- 13 C]-citrate. h Fractional labeling of acetyl-CoA (m + 2) and malate (m + 4) in isolated SDH-KO mitochondria cultured with [U- 13 C]-citrate with or without ATP and ACLY inhibitor (BMS-303141). i Relative cell viability for SDH-WT (green) and SDH-KO cells (orange) following the addition of increasing concentration of dichloroacetate (DCA). XTT cell viability assay was performed 72 h after DCA treatment. j Relative metabolite pool sizes in SDH-WT (green) and SDH-KO cells (orange) with 10 mM DCA (24 h); compared to untreated control. k Metabolite fractional labeling from [U- 13 C]-glutamine in SDH-KO cells without (green) or with (orange) 10 mM DCA (24 h). * P < 0.05, ** P < 0.01, and *** P < 0.001 by multiple t -test analysis with FDR correction ( f ) or by two-sample t -test ( c , e , g , and h ). n.d. not detected. Data are mean ± SD, n = 3 independent biological replicates

Article Snippet: Mitochondria were prepared with the magnetic beads method (Mitochondria Isolation Kit; Miltenyi Biotec,), and the resulting mitochondrial pellets were reconstituted in assay buffer (125 mM KCl, 10 mM Tris/MOPS, 0.1 mM EGTA/Tris, 1 mM Pi, pH 7.4) supplied with indicated nutrients and tracer .

Techniques: Isotopic Labeling, Expressing, Isolation, Labeling, Cell Culture, Concentration Assay, Viability Assay, Control

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 5 Activation of KEAP1-PGAM5-AIFM1 signaling axis in SNG-induced oxeiptosis. A HT-29 cells were treated with SNG for indicated time and Western blot analysis was carried out. The signal intensities of western blot bands were normalized to actin of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05, **p < 0.01, ***p < 0.001 and ns = no significance. B HT-29 and CaCo-2 cells were treated with SNG for 16 h and 6 h, respectively. Following the treatment, Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001. C Cells were treated with SNG in the presence or absence of NAC, and Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, **p < 0.01 and ***p < 0.001. KEAP1-shRNAs-transfected HT-29 cells were treated with the indicated concentrations of SNG for 16 h. Following the treatment, D cell viability was performed by MTT assay. Data shown are mean ± SD (n = 3) (***p < 0.001), E crystal violet staining, Scale bar: 10 µm, and F Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, ***p < 0.001.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: Activation Assay, Western Blot, Transfection, MTT Assay, Staining

Journal: Cell death discovery

Article Title: Targeting oxeiptosis-mediated tumor suppression: a novel approach to treat colorectal cancers by sanguinarine.

doi: 10.1038/s41420-023-01376-3

Figure Lengend Snippet: Fig. 7 Oxeiptosis is involved in SNG-induced tumor suppression in vivo. Mice were subcutaneously inoculated with HT-29 cells into the right flanks and randomly divided into two groups (n = 5). Mice were injected intraperitoneally (i.p.) with 6 mg/kg/ SNG or an equal volume of vehicle. A Individual value plot showing the weights of HT-29 tumor xenografts in the vehicle and SNG treatment groups. Data shown are mean ± SD (n = 5) (**p < 0.01). B Tumor volumes of HT-29 xenograft tumors with the different time points (days) after exposure to SNG. Data shown are mean ± SD (n = 5) (***p < 0.001). C Western blot analysis of indicated proteins was performed. The signal intensities of western blot bands were normalized to AIFM1 of each group, and fold changes were plotted in a histogram from three independent experiments. Significant difference, *p < 0.05 D The relative body weight was evaluated during the treatment. Data shown are mean ± SD (n = 5). E H&E- stained liver and kidney sections obtained from the mice treated with vehicle and SNG are shown. Scale bar: 100 µm.

Article Snippet: Cell Death Discovery (2023) 9:94 shRNA-mediated knockdown shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA): PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA shCont: GCACTACCAGAGCTAACTCAGATAGTACT Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions.

Techniques: In Vivo, Injection, Western Blot, Staining

Journal: International Journal of Molecular Sciences

Article Title: Connexin Expression Is Altered in Liver Development of Yotari ( dab1 -/- ) Mice

doi: 10.3390/ijms221910712

Figure Lengend Snippet: Primary and secondary antibodies used in the study.

Article Snippet: , Human/Mouse/Rat AIF , AF5824 , Sheep , 1:300 , R&DSystems (Minneapolis, MN, SUA).

Techniques: Recombinant

Journal: Genetics and Molecular Biology

Article Title: Whole exome sequencing identifies a novel variant in an apoptosis-inducing factor gene associated with X-linked recessive hearing loss in a Chinese family

doi: 10.1590/1678-4685-gmb-2018-0051

Figure Lengend Snippet: Figure 1 - Variant analysis of AIFM1. (A) Pedigree of Family #36 demonstrates X-linked recessive inheritance hearing loss. Open symbols, unaffected; solid symbols, affected. Squares, male; circles, female; slashed, deceased individual. Slanting arrow, the proband. Family members annotated with the C symbol had no variant in AIFM1, those with the C/T symbol are carriers with the c.1463C>T (p.Pro488Leu) variant in AIFM1, those with the T symbol are patients with the c.1463C>T (p.Pro488Leu) variant in AIFM1, and those without the symbols were not examined. Segregation of hearing loss with the c.1463C>T (p.Pro488Leu) variant in AIFM1 is remarkable in this pedigree. (B) A heterozygous c.1463C>T (p.Pro488Leu) variant of the AIFM1 gene was identified in the carriers and the hemizygous variant was detected in the affected members in this pedigree. (C) Conservation analysis showed that Pro488 in human AIFM1 is conserved across human, rhesus, mouse, dog, elephant, chicken, Xenopus tropicalis, and zebrafish. (D) Pure tone audiometry in the four affected members of Family #36 were indicated. (E) Changes in HEK293 cells expressing c.1463C>T (p.Pro488Leu) mutant AIFM1. HEK293 cells were transfected with empty vector, wild-type AIFM1 plasmid and mutant-type AIFM1 plasmid, respectively. After transfection for 48 h, apoptotic cell ratios were determined with annexin-V-PE-staining. Data represent the mean and standard deviation of three experiments. The asterisks (*) indicate significant differences between the control and experimental groups or differences between the wild-type group and the mutant-type group (*p<0.001).

Article Snippet: Apoptosis effects of the candidate variants A mammalian expression plasmid containing an open reading frame of human AIFM1 cDNA with a green fluorescent protein (GFP) tag at the 3ʹ end was obtained from Origene (Rockville, MD, USA).

Techniques: Variant Assay, Expressing, Mutagenesis, Transfection, Plasmid Preparation, Staining, Standard Deviation, Control

Journal: Genetics and Molecular Biology

Article Title: Whole exome sequencing identifies a novel variant in an apoptosis-inducing factor gene associated with X-linked recessive hearing loss in a Chinese family

doi: 10.1590/1678-4685-gmb-2018-0051

Figure Lengend Snippet: Figure 2 - The three-dimensional structure of wild-type and mutant AIFM1. The crystal structure of mutant AIFM1 was constructed using the Swiss Model platform with the template of wild-type monomeric human AIFM1.

Article Snippet: Apoptosis effects of the candidate variants A mammalian expression plasmid containing an open reading frame of human AIFM1 cDNA with a green fluorescent protein (GFP) tag at the 3ʹ end was obtained from Origene (Rockville, MD, USA).

Techniques: Mutagenesis, Construct

Journal: Cell Research

Article Title: AIF-regulated oxidative phosphorylation supports lung cancer development

doi: 10.1038/s41422-019-0181-4

Figure Lengend Snippet: AIF knockdown results in suppression of OXPHOS, clonogenic potential and cell proliferation in human NSCLC A549 lung tumor cells. a Cellular extracts from A549 clones, generated by lentiviral transduction with shRNA scramble (SCR) or two different shRNA constructs targeting AIF (shAIF1 and shAIF2), were analyzed by immunoblot for the abundance of the indicated proteins. See Supplementary information, Fig. for quantification. b Representative OCR of A549 SCR, shAIF1 and shAIF2 clones under basal conditions or following the addition of 1 μM oligomycin, 1.5 μM of the uncoupler FCCP or 0.5 μM of the electron transport inhibitor rotenone ( n = 5). c Quantification of basal respiration, ATP consumption and maximal respiration levels for SCR, shAIF1, and shAIF2 A549 clones. Results were normalized versus a SCR clone cells/well number and expressed as means ± SEM (experiment was done in triplicate with similar results). d Representative cell growth assay of SCR, shAIF1 and shAIF2 A549 lung tumor clones (I, 500 cells/well; II, 1000 cells/well, and III, 2000 cells/well), analyzed by GFP fluorescence at 72 h post-seeding. e The indicated SCR, shAIF1 and shAIF2 A549 clones were plated (I, 500 cells/well; II, 1000 cells/well and III, 2000 cells/well) and colony numbers were quantified by GFP fluorescence at 0, 24, 48 and 72 h post-seeding. Values are means ± SEM of a representative experiment containing 24 repeats of each condition (experiment was done in triplicate with similar results). Unpaired two-sided t -test, * P < 0.05; ** P < 0.01; *** P < 0.001 in case of immunoblot and oxygen consumption studies and two-way ANOVA and Bonferroni’s post hoc test in case of cell proliferation studies, compared to control SCR cells

Article Snippet: The human lung tumor cells were infected with scrambled (SCR) shRNAs and different shRNAs targeting human AIF or CHCHD4 using the pGFP-C-shLenti vector (Origene).

Techniques: Clone Assay, Generated, Transduction, shRNA, Construct, Western Blot, Growth Assay, Fluorescence